tdbR00000868

NameValue
Coding AA: Thr
Anticodon sequence: AGU
Organism: Schizosaccharomyces pombe NCBI:txid4896
RNA type: cytoplasmic
Sequence: GCUCUUGUAGCUCAGUGGUAGAGCRCUUGC’UAGUAAGCAAGAGGCCCAGUGUUCAAGUCACUGCUGGAGCACCA
Unmodified sequence: GCUCUUGUAGCUCAGUGGUAGAGCGCUUGCCUAGUAAGCAAGAGGCCCAGUGUUCAAGUCACUGCUGGAGCACCA
Secondary structure: (((((.(..((((.......)))).(((((.......))))).....(((((.......)))))).)))))....
Homology model or
structure extracted from PDB:
Model (last update Sept. 6, 2019)
Prepared by: Database creators
Version: 1 (Sept. 6, 2019), created: May 30, 2019, modified: Sept. 23, 2019
Folding free energy [kcal/mol]: -20.40
Pre-aligned sequence:
Pre-aligned secondary structure:
-GCUCUUGUAGCUCAGU--GGU--AGAGCRCUUGC’UAGUAAGCAAGAG-------------------GCCCAGUGUUCAAGUCACUGCUGGAGCACCA
.(((((.(..((((...........)))).(((((.......)))))........................(((((.......)))))).)))))....
Publications:
  • RNA Polymerase III Output Is Functionally Linked to tRNA Dimethyl-G26 Modification.
    Aneeshkumar G Arimbasseri, Nathan H Blewett, James R Iben, Tek N Lamichhane, Vera Cherkasova, Markus Hafner, Richard J Maraia
    PLoS genetics
    volume: 11 issue: 12 epub: Dec. 31, 2015 PUBMED ID: 26720005 DOI: 10.1371/journal.pgen.1005671
  • Evolving specificity of tRNA 3-methyl-cytidine-32 (m3C32) modification: a subset of tRNAsSer requires N6-isopentenylation of A37.
    Aneeshkumar G Arimbasseri, James Iben, Fan-Yan Wei, Keshab Rijal, Kazuhito Tomizawa, Markus Hafner, Richard J Maraia
    RNA (New York, N.Y.)
    volume: 22 issue: 9 epub: June 27, 2016 PUBMED ID: 27354703 DOI: 10.1261/rna.056259.116
Comments: Sequence obtained from hydro-tRNAseq, only two modification studied, 25 partially modified; 31 partially modified
Your browser does not support the canvas element.