tdbR00000869

Name	Value
Coding AA:	Thr
Anticodon sequence:	CGU
Organism:	Schizosaccharomyces pombe NCBI:txid4896
RNA type:	cytoplasmic
Sequence:	GCUCUUGUAGCUCAGUGGUAGAGCRCCUGU’UCGUAAACAGGAGGUCCAGUGUUCGAGUCACUGCCGGAGCACCA
Unmodified sequence:	GCUCUUGUAGCUCAGUGGUAGAGCGCCUGUCUCGUAAACAGGAGGUCCAGUGUUCGAGUCACUGCCGGAGCACCA
Secondary structure:	(((((.(..((((.......)))).(((((.......))))).....(((((.......)))))).)))))....
Homology model or structure extracted from PDB:	Model (last update Sept. 6, 2019)
Prepared by:	Database creators
Version:	1 (Sept. 6, 2019), created: May 30, 2019, modified: Sept. 23, 2019
Folding free energy [kcal/mol]:	-20.70
Pre-aligned sequence: Pre-aligned secondary structure:	-GCUCUUGUAGCUCAGU--GGU--AGAGCRCCUGU’UCGUAAACAGGAG-------------------GUCCAGUGUUCGAGUCACUGCCGGAGCACCA .(((((.(..((((...........)))).(((((.......)))))........................(((((.......)))))).)))))....
Publications:	RNA Polymerase III Output Is Functionally Linked to tRNA Dimethyl-G26 Modification. Aneeshkumar G Arimbasseri, Nathan H Blewett, James R Iben, Tek N Lamichhane, Vera Cherkasova, Markus Hafner, Richard J Maraia PLoS genetics volume: 11 issue: 12 epub: Dec. 31, 2015 PUBMED ID: 26720005 DOI: 10.1371/journal.pgen.1005671 Evolving specificity of tRNA 3-methyl-cytidine-32 (m3C32) modification: a subset of tRNAsSer requires N6-isopentenylation of A37. Aneeshkumar G Arimbasseri, James Iben, Fan-Yan Wei, Keshab Rijal, Kazuhito Tomizawa, Markus Hafner, Richard J Maraia RNA (New York, N.Y.) volume: 22 issue: 9 epub: June 27, 2016 PUBMED ID: 27354703 DOI: 10.1261/rna.056259.116
Comments:	Sequence obtained from hydro-tRNAseq, only two modification studied, 25 partially modified; 31 partially modified