We are using technical cookies that are necessary for page to work correctly.

tdbR00000870

NameValue
Coding AA: Thr
Anticodon sequence: UGU
Organism: Schizosaccharomyces pombe NCBI:txid4896
RNA type: cytoplasmic
Sequence: GCCUCUAUGGCUUAGUGGUACAGCAUCGCA’UUGUAAUGCGAAGAUCCUUGGUUCGAUUCCGAGUGGAGGCACCA
Unmodified sequence: GCCUCUAUGGCUUAGUGGUACAGCAUCGCACUUGUAAUGCGAAGAUCCUUGGUUCGAUUCCGAGUGGAGGCACCA
Secondary structure: (((((((..(((.........))).(((((.......))))).....(((((.......))))))))))))....
Homology model or
structure extracted from PDB:
Model Download (by Moderna) Download (by RNA Composer) (last update July 2, 2025)
Prepared by: Database creators
Version: 1 (Sept. 6, 2019), created: May 30, 2019, modified: July 2, 2025
Folding free energy [kcal/mol]: -20.40
Pre-aligned sequence:
Pre-aligned secondary structure:
-GCCUCUAUGGCUUAGU--GGU--ACAGCAUCGCA’UUGUAAUGCGAAG-------------------AUCCUUGGUUCGAUUCCGAGUGGAGGCACCA
.(((((((..(((.............))).(((((.......)))))........................(((((.......))))))))))))....
Publications:
  • RNA Polymerase III Output Is Functionally Linked to tRNA Dimethyl-G26 Modification.
    Aneeshkumar G Arimbasseri, Nathan H Blewett, James R Iben, Tek N Lamichhane, Vera Cherkasova, Markus Hafner, Richard J Maraia
    PLoS genetics
    volume: 11 issue: 12 epub: Dec. 31, 2015 PUBMED ID: 26720005 DOI: e1005671
  • Evolving specificity of tRNA 3-methyl-cytidine-32 (m3C32) modification: a subset of tRNAsSer requires N6-isopentenylation of A37.
    Aneeshkumar G Arimbasseri, James Iben, Fan-Yan Wei, Keshab Rijal, Kazuhito Tomizawa, Markus Hafner, Richard J Maraia
    RNA (New York, N.Y.)
    volume: 22 issue: 9 epub: June 27, 2016 PUBMED ID: 27354703 DOI: 10.1261/rna.056259.116
Comments: Sequence obtained from hydro-tRNAseq; only single modification studied; 31 partially modified

Secondary structure

Your browser does not support the canvas element.

Tertiary structure

Model based on:
Moderna
RNA Composer