We are using technical cookies that are necessary for page to work correctly.

tdbR00000484

NameValue
Coding AA: Trp
Anticodon sequence: CCA
Organism: Escherichia coli NCBI:txid562
RNA type: cytoplasmic
Sequence: AGGGGCG4AGUUCAADDGGDAGAGCACCGGUBUCCA*AACCGGGU7UUGGGAGTPCGAGUCUCUCCGCCCCUGCCA
Unmodified sequence: AGGGGCGUAGUUCAAUUGGUAGAGCACCGGUCUCCAAAACCGGGUGUUGGGAGUUCGAGUCUCUCCGCCCCUGCCA
Secondary structure: (((((((..((((........)))).(((((.......))))).....(((((.......))))))))))))....
Homology model or
structure extracted from PDB:
Model Download (by RNA Composer) (last update July 2, 2025)
Prepared by: Database creators
Version: 3 (June 29, 2026), created: June 29, 2026, modified: Aug. 17, 2026
Folding free energy [kcal/mol]: -27.80
Pre-aligned sequence:
Pre-aligned secondary structure:
-AGGGGCG4AGUUCAADD-GGD--AGAGCACCGGUBUCCA*AACCGGGU-------------------7UUGGGAGTPCGAGUCUCUCCGCCCCUGCCA
.(((((((..((((...........)))).(((((.......)))))........................(((((.......))))))))))))....
Publications:
  • Tryptophan transfer RNA as the UGA suppressor.
    D Hirsh
    Journal of molecular biology
    volume: 58 issue: 2 date: June 14, 1971 PUBMED ID: 4933412
  • Site-Specific Profiling of 4-Thiouridine Across Transfer RNA Genes in Escherichia coli
    Praneeth Bommisetti, Vahe Bandarian
    ACS omega
    volume: 7 issue: 5 date: Feb. 8, 2022 epub: Jan. 27, 2022 PUBMED ID: 35155896 DOI: 10.1021/acsomega.1c05071
Previous entry: tdbR00000484 (Aug. 17, 2026, 11:33 a.m.)

Aminoacylation

NameValue
Positive identity elements regulating aminoacylation: G73; A1-U72; G2-C71; G3-C70; G4-C69; G5-C68; A9; C34; C35; A36
Negative identity elements antideterminants of aminoacylation: NA
Citation: Xue,H., Shen,W., Gieg´e,R. and Wong,J.T. (1993) Identity elements of tRNATrp. Identification and evolutionary conservation. J. Biol. Chem., 268, 9316–9322.
PMID: 8486627

Secondary structure

Your browser does not support the canvas element.

Tertiary structure

Model based on:
RNA Composer