tdbR00000484 (deprecated)
| Name | Value |
|---|---|
| Coding AA: | Trp |
| Anticodon sequence: | CCA |
| Organism: | Escherichia coli NCBI:txid562 |
| RNA type: | cytoplasmic |
| Sequence: | AGGGGCG4AGUUCAADDGGDAGAGCACCGGUBUCCA*AACCGGGU7UUGGGAGTPCGAGUCUCUCCGCCCCUGCCA |
| Unmodified sequence: | AGGGGCGUAGUUCAAUUGGUAGAGCACCGGUCUCCAAAACCGGGUGUUGGGAGUUCGAGUCUCUCCGCCCCUGCCA |
| Secondary structure: | (((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))).... |
| Homology model or structure extracted from PDB: |
Model Download (by RNA Composer) (last update July 2, 2025) |
| Prepared by: | Database creators |
| Version: | 1 (Sept. 6, 2019), created: Feb. 25, 2019, modified: Aug. 17, 2026 |
| Folding free energy [kcal/mol]: | -27.80 |
| Pre-aligned sequence: Pre-aligned secondary structure: |
-AGGGGCG4AGUUCAADD-GGD--AGAGCACCGGUBUCCA*AACCGGGU-------------------7UUGGGAGTPCGAGUCUCUCCGCCCCUGCCA .(((((((..((((...........)))).(((((.......)))))........................(((((.......)))))))))))).... |
| Publications: |
|
| Next entry: | tdbR00000484 (Aug. 26, 2026, 4:26 p.m.) |
Aminoacylation
| Name | Value |
|---|---|
| Positive identity elements regulating aminoacylation: | G73; A1-U72; G2-C71; G3-C70; G4-C69; G5-C68; A9; C34; C35; A36 |
| Negative identity elements antideterminants of aminoacylation: | NA |
| Citation: | Xue,H., Shen,W., Gieg´e,R. and Wong,J.T. (1993) Identity elements of tRNATrp. Identification and evolutionary conservation. J. Biol. Chem., 268, 9316–9322. |
| PMID: | 8486627 |
Secondary structure
Tertiary structure
Model based on:
