We are using technical cookies that are necessary for page to work correctly.

tdbR00000455

NameValue
Coding AA: Val
Anticodon sequence: GAC
Organism: Escherichia coli NCBI:txid562
RNA type: cytoplasmic
Sequence: GCGUUCA4AGCUCAGDDGGDDAGAGCACCACCUUGACAUGGUGGGG7XCGUUGGTPCGAGUCCAAUUGAACGCACCA
Unmodified sequence: GCGUUCAUAGCUCAGUUGGUUAGAGCACCACCUUGACAUGGUGGGGGUCGUUGGUUCGAGUCCAAUUGAACGCACCA
Secondary structure: (((((((..((((.........)))).(((((.......))))).....(((((.......))))))))))))....
Homology model or
structure extracted from PDB:
Model Download (by Moderna) Download (by RNA Composer) (last update July 2, 2025)
Prepared by: Database creators
Version: 3 (June 29, 2026), created: June 29, 2026, modified: Aug. 17, 2026
Folding free energy [kcal/mol]: -26.20
Pre-aligned sequence:
Pre-aligned secondary structure:
-GCGUUCA4AGCUCAGDD-GGDD-AGAGCACCACCUUGACAUGGUGGGG-------------------7XCGUUGGTPCGAGUCCAAUUGAACGCACCA
.(((((((..((((...........)))).(((((.......)))))........................(((((.......))))))))))))....
Publications:
  • Sequence relationship of three valine acceptor tRNAs from Escherichia coli.
    M Yaniv, B G Barrell
    Nature: New biology
    volume: 233 issue: 38 date: Sept. 22, 1971 PUBMED ID: 4937864
  • Site-Specific Profiling of 4-Thiouridine Across Transfer RNA Genes in Escherichia coli
    Praneeth Bommisetti, Vahe Bandarian
    ACS omega
    volume: 7 issue: 5 date: Feb. 8, 2022 epub: Jan. 27, 2022 PUBMED ID: 35155896 DOI: 10.1021/acsomega.1c05071
Previous entry: tdbR00000455 (Aug. 17, 2026, 11:33 a.m.)

Aminoacylation

NameValue
Positive identity elements regulating aminoacylation: A73; G3-C70; U4-A69; A35; C36; G20; G45
Negative identity elements antideterminants of aminoacylation: Efficient mischarging of tRNAIle and tRNAMet by ValRS reflects overlap of A73/A35 identity features.
Citation: Tardif,K.D. and Horowitz,J. (2004) Functional group recognition at the aminoacylation and editing sites of E. coli valyl-tRNA synthetase. RNA, 10, 493–503.
DOI: 10.1261/rna.5166704
PMID: 14970394

Secondary structure

Your browser does not support the canvas element.

Tertiary structure

Model based on:
Moderna
RNA Composer