tdbR00000455 (deprecated)
| Name | Value |
|---|---|
| Coding AA: | Val |
| Anticodon sequence: | GAC |
| Organism: | Escherichia coli NCBI:txid562 |
| RNA type: | cytoplasmic |
| Sequence: | GCGUUCA4AGCUCAGDDGGDDAGAGCACCACCUUGACAUGGUGGGG7XCGUUGGTPCGAGUCCAAUUGAACGCACCA |
| Unmodified sequence: | GCGUUCAUAGCUCAGUUGGUUAGAGCACCACCUUGACAUGGUGGGGGUCGUUGGUUCGAGUCCAAUUGAACGCACCA |
| Secondary structure: | (((((((..((((.........)))).(((((.......))))).....(((((.......)))))))))))).... |
| Homology model or structure extracted from PDB: |
Model Download (by Moderna) Download (by RNA Composer) (last update July 2, 2025) |
| Prepared by: | Database creators |
| Version: | 1 (Sept. 6, 2019), created: Feb. 25, 2019, modified: Aug. 17, 2026 |
| Folding free energy [kcal/mol]: | -26.20 |
| Pre-aligned sequence: Pre-aligned secondary structure: |
-GCGUUCA4AGCUCAGDD-GGDD-AGAGCACCACCUUGACAUGGUGGGG-------------------7XCGUUGGTPCGAGUCCAAUUGAACGCACCA .(((((((..((((...........)))).(((((.......)))))........................(((((.......)))))))))))).... |
| Publications: |
|
| Next entry: | tdbR00000455 (Aug. 26, 2026, 4:24 p.m.) |
Aminoacylation
| Name | Value |
|---|---|
| Positive identity elements regulating aminoacylation: | A73; G3-C70; U4-A69; A35; C36; G20; G45 |
| Negative identity elements antideterminants of aminoacylation: | Efficient mischarging of tRNAIle and tRNAMet by ValRS reflects overlap of A73/A35 identity features. |
| Citation: | Tardif,K.D. and Horowitz,J. (2004) Functional group recognition at the aminoacylation and editing sites of E. coli valyl-tRNA synthetase. RNA, 10, 493–503. |
| DOI: | 10.1261/rna.5166704 |
| PMID: | 14970394 |
Secondary structure
Tertiary structure
Model based on:
