We are using technical cookies that are necessary for page to work correctly.

tdbR00000295

Name	Value
Coding AA:	Asn
Anticodon sequence:	QUU
Organism:	Escherichia coli NCBI:txid562
RNA type:	cytoplasmic
Sequence:	UCCUCUG4AGUUCAGDCGGDAGAACGGCGGACUQUU6APCCGUAU7UCACUGGTPCGAGUCCAGUCAGAGGAGCCA
Unmodified sequence:	UCCUCUGUAGUUCAGUCGGUAGAACGGCGGACUGUUAAUCCGUAUGUCACUGGUUCGAGUCCAGUCAGAGGAGCCA
Secondary structure:	(((((((..((((........)))).(((((.......))))).....(((((.......))))))))))))....
Homology model or structure extracted from PDB:	Model Download (by Moderna) Download (by RNA Composer) (last update July 2, 2025)
Prepared by:	Database creators
Version:	3 (June 29, 2026), created: June 29, 2026, modified: Aug. 17, 2026
Folding free energy [kcal/mol]:	-23.30
Pre-aligned sequence: Pre-aligned secondary structure:	-UCCUCUG4AGUUCAGDC-GGD--AGAACGGCGGACUQUU6APCCGUAU-------------------7UCACUGGTPCGAGUCCAGUCAGAGGAGCCA .(((((((..((((...........)))).(((((.......)))))........................(((((.......))))))))))))....
Publications:	The nucleotide sequence of asparagine tRNA from Escherichia coli. K Ohashi, F Harada, Z Ohashi, S Nishimura, T S Stewart, G Vogeli, T McCutchan, D Soll Nucleic acids research volume: 3 issue: 12 PUBMED ID: 794837 Site-Specific Profiling of 4-Thiouridine Across Transfer RNA Genes in Escherichia coli Praneeth Bommisetti, Vahe Bandarian ACS omega volume: 7 issue: 5 date: Feb. 8, 2022 epub: Jan. 27, 2022 PUBMED ID: 35155896 DOI: 10.1021/acsomega.1c05071
Previous entry:	tdbR00000295 (Aug. 17, 2026, 11:33 a.m.)

Aminoacylation

Name	Value
Positive identity elements regulating aminoacylation:	G73; G34; U35; U36; A37
Negative identity elements antideterminants of aminoacylation:	NA
Citation:	Martin,F., Eriani,G., Reinbolt,J., Dirheimer,G. and Gangloff,J. (1995) Genetic selection for active E. coli amber tRNAAsn exclusively led to glutamine inserting suppressors. Nucleic Acids Res., 23, 779–784.
PMID:	7708493

Secondary structure

Tertiary structure

Model based on:

Moderna

RNA Composer