tdbR00000295 (deprecated)
| Name | Value |
|---|---|
| Coding AA: | Asn |
| Anticodon sequence: | QUU |
| Organism: | Escherichia coli NCBI:txid562 |
| RNA type: | cytoplasmic |
| Sequence: | UCCUCUG4AGUUCAGDCGGDAGAACGGCGGACUQUU6APCCGUAU7UCACUGGTPCGAGUCCAGUCAGAGGAGCCA |
| Unmodified sequence: | UCCUCUGUAGUUCAGUCGGUAGAACGGCGGACUGUUAAUCCGUAUGUCACUGGUUCGAGUCCAGUCAGAGGAGCCA |
| Secondary structure: | (((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))).... |
| Homology model or structure extracted from PDB: |
Model Download (by Moderna) Download (by RNA Composer) (last update July 2, 2025) |
| Prepared by: | Database creators |
| Version: | 1 (Sept. 6, 2019), created: Feb. 25, 2019, modified: Aug. 17, 2026 |
| Folding free energy [kcal/mol]: | -23.30 |
| Pre-aligned sequence: Pre-aligned secondary structure: |
-UCCUCUG4AGUUCAGDC-GGD--AGAACGGCGGACUQUU6APCCGUAU-------------------7UCACUGGTPCGAGUCCAGUCAGAGGAGCCA .(((((((..((((...........)))).(((((.......)))))........................(((((.......)))))))))))).... |
| Publications: |
|
| Next entry: | tdbR00000295 (Aug. 26, 2026, 4:26 p.m.) |
Aminoacylation
| Name | Value |
|---|---|
| Positive identity elements regulating aminoacylation: | G73; G34; U35; U36; A37 |
| Negative identity elements antideterminants of aminoacylation: | NA |
| Citation: | Martin,F., Eriani,G., Reinbolt,J., Dirheimer,G. and Gangloff,J. (1995) Genetic selection for active E. coli amber tRNAAsn exclusively led to glutamine inserting suppressors. Nucleic Acids Res., 23, 779–784. |
| PMID: | 7708493 |
Secondary structure
Tertiary structure
Model based on:
