We are using technical cookies that are necessary for page to work correctly.

tdbR00000020

NameValue
Coding AA: Cys
Anticodon sequence: GCA
Organism: Escherichia coli NCBI:txid562
RNA type: cytoplasmic
Sequence: GGCGCGU4AACAAAGCGGDDAUGUAGCGGAPUGCA*APCCGUCUAGUCCGGTPCGACUCCGGAACGCGCCUCCA
Unmodified sequence: GGCGCGUUAACAAAGCGGUUAUGUAGCGGAUUGCAAAUCCGUCUAGUCCGGUUCGACUCCGGAACGCGCCUCCA
Secondary structure: (((((((..(((.........))).(((((.......)))))....(((((.......))))))))))))....
PDB ID: 1u0b, 1b23
Prepared by: Database creators
Version: 3 (June 29, 2026), created: June 29, 2026, modified: Aug. 26, 2026
Folding free energy [kcal/mol]: -23.70
Pre-aligned sequence:
Pre-aligned secondary structure:
-GGCGCGU4AACAAAGC--GGD--DAUGUAGCGGAPUGCA*APCCGUCU-------------------A-GUCCGGTPCGACUCCGGAACGCGCCUCCA
.(((((((..(((.............))).(((((.......)))))........................(((((.......))))))))))))....
Publications:
  • Cysteine transfer RNA of Escherichia coli: nucleotide sequence and unusual metabolic properties of the 3' C-C-A terminus.
    G P Mazzara, W H McClain
    Journal of molecular biology
    volume: 117 issue: 4 date: Dec. 25, 1977 PUBMED ID: 342705
  • Shape-selective RNA recognition by cysteinyl-tRNA synthetase.
    Scott Hauenstein, Chun-Mei Zhang, Ya-Ming Hou, John J Perona
    Nature structural & molecular biology
    volume: 11 issue: 11 epub: Oct. 17, 2004 PUBMED ID: 15489861
  • The crystal structure of Cys-tRNACys-EF-Tu-GDPNP reveals general and specific features in the ternary complex and in tRNA.
    P Nissen, S Thirup, M Kjeldgaard, J Nyborg
    Structure (London, England : 1993)
    volume: 7 issue: 2 date: Feb. 15, 1999 PUBMED ID: 10368282
  • Site-Specific Profiling of 4-Thiouridine Across Transfer RNA Genes in Escherichia coli
    Praneeth Bommisetti, Vahe Bandarian
    ACS omega
    volume: 7 issue: 5 date: Feb. 8, 2022 epub: Jan. 27, 2022 PUBMED ID: 35155896 DOI: 10.1021/acsomega.1c05071
Previous entry: tdbR00000020 (Aug. 17, 2026, 11:33 a.m.)

Secondary structure

Your browser does not support the canvas element.