tdbR00000020

Name	Value
Coding AA:	Cys
Anticodon sequence:	GCA
Organism:	Escherichia coli NCBI:txid562
RNA type:	cytoplasmic
Sequence:	GGCGCGU4AACAAAGCGGDDAUGUAGCGGAPUGCA*APCCGUCUAGUCCGGTPCGACUCCGGAACGCGCCUCCA
Unmodified sequence:	GGCGCGUUAACAAAGCGGUUAUGUAGCGGAUUGCAAAUCCGUCUAGUCCGGUUCGACUCCGGAACGCGCCUCCA
Secondary structure:	(((((((..(((.........))).(((((.......)))))....(((((.......))))))))))))....
PDB ID:	1u0b, 1b23
Prepared by:	Database creators
Version:	3 (June 29, 2026), created: June 29, 2026, modified: Aug. 17, 2026
Folding free energy [kcal/mol]:	-23.70
Pre-aligned sequence: Pre-aligned secondary structure:	-GGCGCGU4AACAAAGC--GGD--DAUGUAGCGGAPUGCA*APCCGUCU-------------------A-GUCCGGTPCGACUCCGGAACGCGCCUCCA .(((((((..(((.............))).(((((.......)))))........................(((((.......))))))))))))....
Publications:	Cysteine transfer RNA of Escherichia coli: nucleotide sequence and unusual metabolic properties of the 3' C-C-A terminus. G P Mazzara, W H McClain Journal of molecular biology volume: 117 issue: 4 date: Dec. 25, 1977 PUBMED ID: 342705 Shape-selective RNA recognition by cysteinyl-tRNA synthetase. Scott Hauenstein, Chun-Mei Zhang, Ya-Ming Hou, John J Perona Nature structural & molecular biology volume: 11 issue: 11 epub: Oct. 17, 2004 PUBMED ID: 15489861 The crystal structure of Cys-tRNACys-EF-Tu-GDPNP reveals general and specific features in the ternary complex and in tRNA. P Nissen, S Thirup, M Kjeldgaard, J Nyborg Structure (London, England : 1993) volume: 7 issue: 2 date: Feb. 15, 1999 PUBMED ID: 10368282 Site-Specific Profiling of 4-Thiouridine Across Transfer RNA Genes in Escherichia coli Praneeth Bommisetti, Vahe Bandarian ACS omega volume: 7 issue: 5 date: Feb. 8, 2022 epub: Jan. 27, 2022 PUBMED ID: 35155896 DOI: 10.1021/acsomega.1c05071
Previous entry:	tdbR00000020 (Aug. 17, 2026, 11:33 a.m.)

tdbR00000020

Secondary structure