We are using technical cookies that are necessary for page to work correctly.

tdbR00000249

NameValue
Coding AA: Leu
Anticodon sequence: CAA
Organism: Saccharomyces cerevisiae NCBI:txid4932
RNA type: cytoplasmic
Sequence: GGUUGUUUGLCMGAGC#GDCDAAGGCRCCUGAPU?AAKCPCAGGUAUCGUAAGAUG?AAGAGTPCGAAUCUCUUAGCAACCACCA
Unmodified sequence: GGUUGUUUGGCCGAGCGGUCUAAGGCGCCUGAUUCAAGCUCAGGUAUCGUAAGAUGCAAGAGUUCGAAUCUCUUAGCAACCACCA
Secondary structure: (((((((..(((...........)))((((((.......))))))............(((((.......))))))))))))....
Homology model or
structure extracted from PDB:
Model Download (by Moderna) Download (by RNA Composer) (last update July 2, 2025)
Prepared by: Database creators
Version: 3 (June 29, 2026), created: June 29, 2026, modified: Aug. 26, 2026
Folding free energy [kcal/mol]: -22.00
Pre-aligned sequence:
Pre-aligned secondary structure:
-GGUUGUUUGLCMGAGC--#GDCDAAGGCRCCUGAPU?AAKCPCAGGU-AUC----GUAA-----GAUG-?AAGAGTPCGAAUCUCUUAGCAACCACCA
.(((((((..(((.............)))((((((.......)))))).......................(((((.......))))))))))))....
Publications:
  • The corrected nucleotide sequence of yeast leucine transfer ribonucleic acid.
    S H Chang, S Kuo, E Hawkins, N R Miller
    Biochemical and biophysical research communications
    volume: 51 issue: 4 date: April 16, 1973 PUBMED ID: 4574158
  • Direct sequencing of total Saccharomyces cerevisiae tRNAs by LC-MS/MS
    Joshua D Jones, Kaley M Simcox, Robert T Kennedy, Kristin S Koutmou
    RNA (New York, N.Y.)
    volume: 29 issue: 8 epub: May 11, 2023 PUBMED ID: 37169396 DOI: 10.1261/rna.079656.123
Previous entry: tdbR00000249 (Aug. 17, 2026, 11:47 a.m.)

Aminoacylation

NameValue
Positive identity elements regulating aminoacylation: A73; C3-G70; A4-U69; G5-C68; long variable arm; U8-A14; G18; m1G37; Y55; G2/G30/C61/C62 context
Negative identity elements antideterminants of aminoacylation: Insertion in the long variable arm can confer Ser acceptance; A73 to G73 can switch Leu toward Ser identity in class-II contexts.
Citation: Soma,A., Kumagai,R., Nishikawa,K. and Himeno,H. (1996) The anticodon loop is a major identity determinant of Saccharomyces cerevisiae tRNALeu. J. Mol. Biol., 263, 707–714.
DOI: 10.1006/jmbi.1996.0610
PMID: 8947570

Secondary structure

Your browser does not support the canvas element.

Tertiary structure

Model based on:
Moderna
RNA Composer