tdbR00000249 (deprecated)
| Name | Value |
|---|---|
| Coding AA: | Leu |
| Anticodon sequence: | CAA |
| Organism: | Saccharomyces cerevisiae NCBI:txid4932 |
| RNA type: | cytoplasmic |
| Sequence: | GGUUGUUUGLCMGAGC#GDCDAAGGCRCCUGAPU?AAKCPCAGGUAUCGUAAGAUG?AAGAGTPCGAAUCUCUUAGCAACCACCA |
| Unmodified sequence: | GGUUGUUUGGCCGAGCGGUCUAAGGCGCCUGAUUCAAGCUCAGGUAUCGUAAGAUGCAAGAGUUCGAAUCUCUUAGCAACCACCA |
| Secondary structure: | (((((((..(((...........)))((((((.......))))))............(((((.......)))))))))))).... |
| Homology model or structure extracted from PDB: |
Model Download (by Moderna) Download (by RNA Composer) (last update July 2, 2025) |
| Prepared by: | Database creators |
| Version: | 1 (Sept. 6, 2019), created: Feb. 25, 2019, modified: Aug. 17, 2026 |
| Folding free energy [kcal/mol]: | -22.00 |
| Pre-aligned sequence: Pre-aligned secondary structure: |
-GGUUGUUUGLCMGAGC--#GDCDAAGGCRCCUGAPU?AAKCPCAGGU-AUC----GUAA-----GAUG-?AAGAGTPCGAAUCUCUUAGCAACCACCA .(((((((..(((.............)))((((((.......)))))).......................(((((.......)))))))))))).... |
| Publications: |
|
| Next entry: | tdbR00000249 (Aug. 17, 2026, 11:47 a.m.) |
Aminoacylation
| Name | Value |
|---|---|
| Positive identity elements regulating aminoacylation: | A73; C3-G70; A4-U69; G5-C68; long variable arm; U8-A14; G18; m1G37; Y55; G2/G30/C61/C62 context |
| Negative identity elements antideterminants of aminoacylation: | Insertion in the long variable arm can confer Ser acceptance; A73 to G73 can switch Leu toward Ser identity in class-II contexts. |
| Citation: | Soma,A., Kumagai,R., Nishikawa,K. and Himeno,H. (1996) The anticodon loop is a major identity determinant of Saccharomyces cerevisiae tRNALeu. J. Mol. Biol., 263, 707–714. |
| DOI: | 10.1006/jmbi.1996.0610 |
| PMID: | 8947570 |
Secondary structure
Tertiary structure
Model based on:
