tdbR00000010 (deprecated)

Name	Value
Coding AA:	Ala
Anticodon sequence:	VGC
Organism:	Escherichia coli NCBI:txid562
RNA type:	cytoplasmic
Sequence:	GGGGCUAUAGCUCAGCDGGGAGAGCGCCUGCUUVGCACGCAGGAG7UCUGCGGTPCGAUCCCGCAUAGCUCCACCA
Unmodified sequence:	GGGGCUAUAGCUCAGCUGGGAGAGCGCCUGCUUUGCACGCAGGAGGUCUGCGGUUCGAUCCCGCAUAGCUCCACCA
Secondary structure:	(((((((..((((........)))).(((((.......))))).....(((((.......))))))))))))....
Homology model or structure extracted from PDB:	Model Download (last update Sept. 6, 2019)
Prepared by:	Database creators
Version:	1 (Sept. 6, 2019), created: Feb. 25, 2019, modified: March 25, 2020
Folding free energy [kcal/mol]:	-29.20
Pre-aligned sequence: Pre-aligned secondary structure:	-GGGGCUAUAGCUCAGCD-GGG--AGAGCGCCUGCUUVGCACGCAGGAG-------------------7UCUGCGGTPCGAUCCCGCAUAGCUCCACCA .(((((((..((((...........)))).(((((.......)))))........................(((((.......))))))))))))....
Publications:	Spacer transfer RNAs in ribosomal RNA transcripts of E. coli: processing of 30S ribosomal RNA in vitro. E Lund, J E Dahlberg Cell volume: 11 issue: 2 PUBMED ID: 329997 Dual pathways of tRNA hydroxylation ensure efficient translation by expanding decoding capability Yusuke Sakai, Satoshi Kimura, Tsutomu Suzuki Nature communications volume: 10 issue: 1 epub: June 28, 2019 PUBMED ID: 31253794 DOI: doi: 10.1038/s41467-019-10750-8
Next entry:	tdbR00000010 (March 25, 2020, 1:11 p.m.)