tdbR00000510 (deprecated)
| Name | Value |
|---|---|
| Coding AA: | Ini |
| Anticodon sequence: | CAU |
| Organism: | Escherichia coli NCBI:txid562 |
| RNA type: | cytoplasmic |
| Sequence: | CGCGGGG4GGAGCAGCCUGGDAGCUCGUCGGGBUCAUAACCCGAAGAUCGUCGGTPCAAAUCCGGCCCCCGCAACCA |
| Unmodified sequence: | CGCGGGGUGGAGCAGCCUGGUAGCUCGUCGGGCUCAUAACCCGAAGAUCGUCGGUUCAAAUCCGGCCCCCGCAACCA |
| Secondary structure: | .((((((..((((.........)))).(((((.......))))).....(((((.......)))))))))))..... |
| Homology model or structure extracted from PDB: |
Model Download (by RNA Composer) (last update July 2, 2025) |
| Prepared by: | Database creators |
| Version: | 1 (Sept. 6, 2019), created: Feb. 25, 2019, modified: Aug. 17, 2026 |
| Folding free energy [kcal/mol]: | -30.30 |
| Pre-aligned sequence: Pre-aligned secondary structure: |
-CGCGGGG4GGAGCAGCCUGGD--AGCUCGUCGGGBUCAUAACCCGAAG-------------------AUCGUCGGTPCAAAUCCGGCCCCCGCAACCA ..((((((..((((...........)))).(((((.......)))))........................(((((.......)))))))))))..... |
| Publications: |
|
| Next entry: | tdbR00000510 (Aug. 17, 2026, 11:33 a.m.) |
Aminoacylation
| Name | Value |
|---|---|
| Positive identity elements regulating aminoacylation: | Initiator Met identity: CAU anticodon C34-A35-U36; initiator-specific acceptor/anticodon-loop context including C32/U33/A37 and formylation-related elements |
| Negative identity elements antideterminants of aminoacylation: | NA |
| Citation: | Pak,M., Pallanck,L. and Schulman,L.H. (1992) Conversion of a methionine initiator tRNA into a tryptophan-inserting elongator tRNA in vivo. Biochemistry, 31, 3303–3309. |
| DOI: | 10.1021/bi00128a001 |
| PMID: | 1554714 |
Secondary structure
Tertiary structure
Model based on:
