tdbR00000181 (deprecated)

Name	Value
Coding AA:	Lys
Anticodon sequence:	SUU
Organism:	Escherichia coli NCBI:txid562
RNA type:	cytoplasmic
Sequence:	GGGUCGUUAGCUCAGDDGGDAGAGCAGUUGACUSUU6APCAAUUG7XCGCAGGTPCGAAUCCUGCACGACCCACCA
Unmodified sequence:	GGGUCGUUAGCUCAGUUGGUAGAGCAGUUGACUUUUAAUCAAUUGGUCGCAGGUUCGAAUCCUGCACGACCCACCA
Secondary structure:	(((((((..((((........))))((((((.......))))))....(((((.......))))))))))))....
Homology model or structure extracted from PDB:	Model Download (last update Sept. 6, 2019)
Prepared by:	Database creators
Version:	1 (Sept. 6, 2019), created: Feb. 25, 2019, modified: March 26, 2020
Folding free energy [kcal/mol]:	-27.10
Pre-aligned sequence: Pre-aligned secondary structure:	-GGGUCGUUAGCUCAGDD-GGD--AGAGCAGUUGACUSUU6APCAAUUG-------------------7XCGCAGGTPCGAAUCCUGCACGACCCACCA .(((((((..((((...........))))((((((.......)))))).......................(((((.......))))))))))))....
Publications:	Primary structure of tRNA-Lys of E. coli B. K Chakraburtty, A Steinschneider, R V Case, A H Mehler Nucleic acids research volume: 2 issue: 11 PUBMED ID: 802509 A cyclic form of N6-threonylcarbamoyladenosine as a widely distributed tRNA hypermodification. Kenjyo Miyauchi, Satoshi Kimura, Tsutomu Suzuki Nature chemical biology volume: 9 issue: 2:105-111 epub: Dec. 16, 2012 PUBMED ID: 23242255 DOI: doi: 10.1038/nchembio.1137
Next entry:	tdbR00000181 (March 26, 2020, 10:26 a.m.)