tdbR00000599 (deprecated)

Name	Value
Coding AA:	Sec
Anticodon sequence:	1CA
Organism:	Xenopus laevis NCBI:txid8355
RNA type:	cytoplasmic
Sequence:	GCCCGGAUGACCCUCAGUGGUCUGGGGUGCAGGCU1CA+ACCUGUAGCUGUCUAGCGACAGAGUGGUPCA"UUCCACCUUUCGGGCGCCA
Unmodified sequence:	GCCCGGAUGACCCUCAGUGGUCUGGGGUGCAGGCUUCAAACCUGUAGCUGUCUAGCGACAGAGUGGUUCAAUUCCACCUUUCGGGCGCCA
Secondary structure:	(((((((..((((........)))).(((((.......)))))................(.(((.......))).))))))))....
Homology model or structure extracted from PDB:	Model (last update Sept. 6, 2019)
Prepared by:	Database creators
Version:	1 (Sept. 6, 2019), created: Feb. 25, 2019, modified: Sept. 22, 2019
Folding free energy [kcal/mol]:	100000.00
Pre-aligned sequence: Pre-aligned secondary structure:	-GCCCGGAU_CCUCAGU--GGU-CUGGGGUGCAGGCU1CA+ACCUGUAGCUGUC--UAGC---GACAG---AGUGGUPCA"UUCCA_UUUCGGGCGCCA .(((((((..((((...........)))).(((((.......)))))........................(.(((.......))).))))))))....
Publications:	Selenocysteine tRNA[Ser]Sec gene is ubiquitous within the animal kingdom. B J Lee, M Rajagopalan, Y S Kim, K H You, K B Jacobson, D Hatfield Molecular and cellular biology volume: 10 issue: 5 PUBMED ID: 2139169 Base modification pattern at the wobble position of Xenopus selenocysteine tRNA(Sec). C Sturchler, A Lescure, G Keith, P Carbon, A Krol Nucleic acids research volume: 22 issue: 8 date: April 25, 1994 PUBMED ID: 8031393
Next entry:	tdbR00000599 (Sept. 23, 2019, 3:18 p.m.)