tdbR00000711
| Name | Value |
|---|---|
| Coding AA: | Leu |
| Anticodon sequence: | UAG |
| Organism: | Homo sapiens NCBI:txid9606 |
| RNA type: | cytoplasmic |
| Sequence: | GGUAGCGUGGCCGAGCGGUCUAAGGCGCUGGAUUUAGGCUCCAGUCUCUUCGGAGGCGUGGGUUCGAAUCCCACCGCUGCCACCA |
| Unmodified sequence: | GGUAGCGUGGCCGAGCGGUCUAAGGCGCUGGAUUUAGGCUCCAGUCUCUUCGGAGGCGUGGGUUCGAAUCCCACCGCUGCCACCA |
| Secondary structure: | (((((((..(((...........)))((((((.......))))))............(((((.......)))))))))))).... |
| Homology model or structure extracted from PDB: |
Model Download (by Moderna) Download (by RNA Composer) (last update July 2, 2025) |
| Prepared by: | Database creators |
| Version: | 1 (Sept. 6, 2019), created: May 30, 2019, modified: June 29, 2026 |
| Folding free energy [kcal/mol]: | -30.10 |
| Pre-aligned sequence: Pre-aligned secondary structure: |
-GGUAGCGUGGCCGAGC--GGUCUAAGGCGCUGGAUUUAGGCUCCAGUCUC------UUCG-----GAGGCGUGGGUUCGAAUCCCACCGCUGCCACCA .(((((((..(((.............)))((((((.......)))))).......................(((((.......)))))))))))).... |
| Variants & Diseases: | Leu-CAG; Leu-UAG; Leu-AAG, breast cancer |
| Publications: |
|
| Comments: | Sequence obtained from hydro-tRNAseq; modified nucleosides were not determined by MS, only predicted by mismatches frequency; relative abundance among tRNALeu in HEK293 cells: 8.7% |
Aminoacylation
| Name | Value |
|---|---|
| Positive identity elements regulating aminoacylation: | A73; class-II tRNA tertiary/variable-arm context; D/T-loop interactions |
| Negative identity elements antideterminants of aminoacylation: | A73->G73 can switch human tRNALeu toward Ser acceptance. |
| Citation: | Metzger,A.U., Heckl,M., Willbold,D., Breitschopf,K., RajBhandary,U.L., R¨osch,P. and Gross,H.J. (1997) Structural studies on tRNA acceptor stem microhelices: exchange of the discriminator base A73 for G in human tRNALeu switches the acceptor specificity from leucine to serine possibly by decreasing the stability of the terminal G1–C72 base pair. Nucleic Acids Res., 25, 4551–4556. |
| DOI: | 10.1093/nar/25.22.4551 |
| PMID: | 9358165 |
Secondary structure
Tertiary structure
Model based on:
