We are using technical cookies that are necessary for page to work correctly.

tdbR00000718

NameValue
Coding AA: Leu
Anticodon sequence: UAG
Organism: Homo sapiens NCBI:txid9606
RNA type: cytoplasmic
Sequence: GGUAGCGUGGCCGAGUGGUCUAAGGCGCUGGAUUUAGGCUCCAGUCAUUUCGAUGGCGUGGGUUCGAAUCCCACCGCUGCCACCA
Unmodified sequence: GGUAGCGUGGCCGAGUGGUCUAAGGCGCUGGAUUUAGGCUCCAGUCAUUUCGAUGGCGUGGGUUCGAAUCCCACCGCUGCCACCA
Secondary structure: (((((((..(((...........)))((((((.......))))))............(((((.......))))))))))))....
Homology model or
structure extracted from PDB:
Model Download (by Moderna) Download (by RNA Composer) (last update July 2, 2025)
Prepared by: Database creators
Version: 1 (Sept. 6, 2019), created: May 30, 2019, modified: Aug. 26, 2026
Folding free energy [kcal/mol]: -30.10
Pre-aligned sequence:
Pre-aligned secondary structure:
-GGUAGCGUGGCCGAGU--GGUCUAAGGCGCUGGAUUUAGGCUCCAGUCAU------UUCG-----AUGGCGUGGGUUCGAAUCCCACCGCUGCCACCA
.(((((((..(((.............)))((((((.......)))))).......................(((((.......))))))))))))....
Variants & Diseases: Leu-CAG; Leu-UAG; Leu-AAG, breast cancer
Publications:
  • Characterizing Expression and Processing of Precursor and Mature Human tRNAs by Hydro-tRNAseq and PAR-CLIP.
    Tasos Gogakos, Miguel Brown, Aitor Garzia, Cindy Meyer, Markus Hafner, Thomas Tuschl
    Cell reports
    volume: 20 issue: 6 date: Aug. 8, 2017 PUBMED ID: 28793268 DOI: 10.1016/j.celrep.2017.07.029
Comments: Sequence obtained from hydro-tRNAseq; modified nucleosides were not determined by MS, only predicted by mismatches frequency; relative abundance among tRNALeu in HEK293 cells: 4.2%

Aminoacylation

NameValue
Positive identity elements regulating aminoacylation: A73; class-II tRNA tertiary/variable-arm context; D/T-loop interactions
Negative identity elements antideterminants of aminoacylation: A73->G73 can switch human tRNALeu toward Ser acceptance.
Citation: Metzger,A.U., Heckl,M., Willbold,D., Breitschopf,K., RajBhandary,U.L., R¨osch,P. and Gross,H.J. (1997) Structural studies on tRNA acceptor stem microhelices: exchange of the discriminator base A73 for G in human tRNALeu switches the acceptor specificity from leucine to serine possibly by decreasing the stability of the terminal G1–C72 base pair. Nucleic Acids Res., 25, 4551–4556.
DOI: 10.1093/nar/25.22.4551
PMID: 9358165

Secondary structure

Your browser does not support the canvas element.

Tertiary structure

Model based on:
Moderna
RNA Composer